EXTREMADURA JUNIO 98. LOGSE


BIOLOGÍA OPCIÓN A


1.- Diferencia entre lípidos saponificables e insaponificables. Poner un ejemplo de cada uno,

indicando su localización y función en la Naturaleza.


2.- Establecer la correspondencia entre los compuestos mencionados en el bloque 1 y los

orgánulos celulares en los que están presentes en el bloque 2, teniendo en cuenta que un

compuesto químico puede estar en más de un orgánulo. (Responder utilizando las letras, por

ejemplo, A en B y C; B en H; etc.).


BLOQUE 1 BLOQUE 2

A) ADN A) Cloroplastos

B) Tubulinas B) Membranas celulares

C) ARNr C) Microtúbulos

D) Bomba de Na+/K+ D) Lisosomas

E) Clorofilas E) Ribosomas

F) Histonas F) Núcleo

G) Hidrolasas ácidas G) Retículo endoplásmico

H) Fosfolípidos H) Centriolos

I) Aparato de Golgi

J) Cilios


3.- Respiración aerobia de la glucosa; ¿Cuáles son los productos resultantes de cada uno de

los tres procesos que comprende?; b) Balance energético comparado con el de las

fermentaciones. Explique por qué es diferente.


4.- Explique las diferentes hipótesis sobre la duplicación del ADN indicando cuál es correcta.


5.- Los anticuerpos y la reacción antígeno/anticuerpo.






















EXTREMADURA / JUNIO 01. LOGSE

BIOLOGIA


OPCION A

  1. Estructura primaria y secundaria de las proteínas.

  1. Indique los procesos con los que están relacionados los siguientes orgánulos:

A.- Ribosomas.

B.- Aparato de Golgi.

C.- Cloroplasto.

D.- Retículo endoplásmico liso.


  1. Fotofosforilación no cíclica: Concepto. Descripción esquemática del proceso.

4. Conteste, de forma concisa, los fenómenos más sobresalientes de las siguientes

fases mitóticas:

A. Metafase.

B. Anafase.


5. Enumere y describa, de forma concisa, los mecanismos de la respuesta inmune

celular.


OPCION B

1. Conteste las siguientes cuestiones sobre los lípidos:

A.- Concepto y propiedades.

B.- Defina y explique los procesos de saponificación y esterificación.


  1. Mitocondria: Estructura y función.

  1. Defina los siguientes conceptos:

A. Anabolismo.

B. Catabolismo.

C. Respiración aerobia.

    D. Fermentación.

4. Describa, brevemente, las etapas del proceso de transcripción en células

eucariotas.


  1. Conteste las siguientes cuestiones sobre los virus:

A. Componentes básicos.

B. Motivo por el que los virus necesitan invadir una célula viva para

multiplicarse.










EXTREMADURA / SEPTIEMBRE 01. LOGSE / BIOLOGIA

REPERTORIO A


1. Defina, brevemente, los siguientes conceptos:

A. Monosacárido.

B. Péptido.

C. Proteína.

  1. Enzima.

  1. Estructura y función de los ribosomas.

3. Conteste a las siguientes cuestiones sobre el ciclo de Krebs:

A. Vía metabólica a la que pertenece.

B. Lugar de la célula donde se realiza.

C. Moléculas de inicio.

  1. Resultado final del proceso.

  1. Importancia y mecanismo de la autoduplicación del ADN.

5. Conteste a las siguientes preguntas sobre inmunidad:

A. Concepto de anticuerpo.

B. Características de la reacción antígeno / anticuerpo.


REPERTORIO B

1. Conteste las siguientes cuestiones sobre las enzimas:

A. Concepto de inhibidor enzimático.

B. Diferencia los tipos de inhibiciones enzimáticas que conozca.


2. Conteste las siguientes cuestiones sobre membrana plasmática:

a. Concepto.

b. Composición química.

c. Estructura.

  1. Función.

    3. Fermentación: Concepto y tipos.

    4. En una especie con dotación cromosómica 2n=20, indique el número de

cromosomas que presentan los siguientes tipos celulares:

A. Ovogonia (Oogonia).

B. Ovocito (Oocito) de primer orden.

C. Ovocito (Oocito) se segundo orden.

  1. Espermátida.

  1. Describa el ciclo lítico de un bacteriófago.









EXTREMADURA / JUNIO 03. LOGSE / BIOLOGÍA


REPERTORIO A

1.- Conteste a las siguientes cuestiones sobre los glúcidos:

A.- Definición.

B.- ¿En qué consiste el enlace O-glicosídico?

C.- Cite compuestos de interés biológico donde aparezcan enlaces alfa (1-6).

D.- Cite algún compuesto estructural que forme parte de los vegetales.


2.- Diferencias entre el transporte activo y pasivo a través de la membrana

celular. Nombre y comente, brevemente, los diferentes tipos de transporte pasivo.


3.- Realice un esquema de las etapas más significativas de la degradación de

la glucosa hasta CO2 + H2O. Indique su localización en la célula.


4.- Describa, brevemente, el proceso de autoduplicación o replicación del

ADN.


5.- Defina los siguientes conceptos:

A.- Biotecnología.

B.- Especies transgénicas.


REPERTORIO B

1.- Indique las funciones, más significativas, de los diferentes tipos de ARN.


2.- Conteste a las siguientes cuestiones sobre los ribosomas:

A.- Composición.

B.- Diferencias entre ribosomas de células eucarióticas y procarióticas.

C.- Función.

D.- Localización.


3.- Explique qué función desempeñan en el metabolismo:

A.- La ribulosa 1,5 - difosfato carboxilasa.

B.- La ATP sintetasa.

C.- Un fotosistema.

D.- El citocromo f.


4.- Compare la mitosis y la meiosis, en cuanto a:

A.- Tipo de células implicadas.

B.- Anafase de la mitosis y Anafase I de la meiosis.

5.- Indique algunos procesos -naturales o artificiales- en los cuales estén

implicadas bacterias o levaduras.











EXTREMADURA / SEPTIEMBRE 03. LOGSE / BIOLOGÍA


REPERTORIO A

1.- Defina los siguientes términos:

A.- Polisacáridos.

B.- Lípidos saponificables.


2.- Lisosomas: Estructura y función.


3.- Establezca las diferencias, más significativas, entre los procesos de

Fotosíntesis y de Quimiosíntesis.


4.- Función del ARN-transferente (ARNt) en la síntesis de proteínas.


5.- Defina los siguientes conceptos:

A.- Ingeniería genética.

B.- Clonación.


REPERTORIO B

1.- Conteste las siguientes cuestiones sobre los polisacáridos:

A.- Concepto y propiedades.

B.- Indique las localizaciones más frecuentes del almidón y del glucógeno.


2.- Defina los siguientes conceptos:

A.- Cromatina.

B.- Cromátidas.

C.- Centrómero.

D.- Cromosomas homólogos.


3.- Fotofosforilación cíclica:

A.- Concepto.

B.- Descripción esquemática del proceso.

4.- Establezca, las diferencias más significativas, del proceso de transcripción

entre las células procariotas y eucariotas.


5.- Conteste a las siguientes cuestiones sobre las inmunoglobulinas:

A.- Naturaleza química y células responsables de su síntesis.

B.- Importancia de su función biológica.















EXTREMADURA / JUNIO 04. LOGSE / BIOLOGIA


REPERTORIO A

1.- Cloroplastos: Estructura y función.


2.- Defina los siguientes términos:

A.- Glucólisis.

B.- Fermentación alcohólica. Cite algún ejemplo de productos

extremeños, con denominación de origen, elaborados por este proceso.


3.- Responda a las siguientes cuestiones sobre las mutaciones:

A.- Concepto.

B.- Mutaciones génicas.


4.- Responda a las siguientes cuestiones sobre los virus:

A.- Características de la cápsida.

B.- Componente genético.

5.- Inmunoglobulinas: Estructura e importancia biológica.


REPERTORIO B

1.- Conteste a las siguientes cuestiones sobre el ARN:

A.- Tipos.

B.- Funciones que desempeñan en la célula


2.- Fotosíntesis: Concepto y breve descripción del Ciclo de Calvin o fase

oscura de la fotosíntesis. (Prescindir de la formulación).


3.- Dada la siguiente secuencia de ADN: 3’TACCTACACAGATCTTGC5’

A.- Escriba la cadena complementaria.

B.- Escriba la secuencia de ARNm (ARN-mensajero) de la cadena dada.


4.- Genoma humano: Interés biológico.


5.- Establezca las diferencias, más significativas, entre sueros y vacunas.



















EXTREMADURA / SEPTIEMBRE 04. LOGSE / BIOLOGIA


REPERTORIO A

1.- Conteste a las siguientes cuestiones:

A.- Estructura secundaria de las proteínas.

B.- El colesterol. Productos extremeños que ayudan a rebajar el nivel del

mismo.


2.- En la respiración aerobia indique:

A.- Etapas más significativas del proceso.

B.- Localización en la célula.


3.- Describa el proceso de transcripción del ADN.


4.- Describa el ciclo lítico de un bacteriófago.


5.- Defina los siguientes conceptos:

A.- Patogenicidad.

B.- Trasplantes.

C.- Alergia.

D.- Linfocitos T.


REPERTORIO B


1.- Defina los siguientes términos:

A.- Centrosoma.

B.- Cloroplasto.


2.- Procesos de formación de ATP en la célula: Principales reacciones y

localización.


3.- La siguiente cadena de ADN: 5’TACATGACATATTCTTTAAACGAC3’,

codifica para la síntesis de un polipéptido. Se pregunta:

A.- El ARNm (mensajero) resultante de la transcripción de la cadena

propuesta.

B.- El número de aminoácidos de la cadena polipeptídica resultante en el

proceso de traducción.


4.- Establezca las diferencias, más acusadas, entre las células procariotas

y eucariotas.


5.- Explique, de forma concisa, en qué consiste la respuesta inmune

celular.











EXTREMADURA / JUNIO 05. LOGSE / BIOLOGIA


REPERTORIO A

1.- Defina los siguientes conceptos:

A. Estructura secundaria de las proteínas.

B. Enzimas alostéricos.


2.- Defina los siguientes procesos:

A.- Glucólisis.

B.- Fermentación alcohólica. Cite algún ejemplo de productos

extremeños, con denominación de origen, elaborados por este proceso.


3.- Responda qué función desempeñan en el metabolismo:

A.- La ribulosa 1,5-difosfato carboxilasa.

B.- La ATP sintetasa.

C.- Un fotosistema.

D.- El citocromo f.


4.- Diferencias fundamentales entre la Profase de la mitosis y la Profase I

de la meiosis.

5.- Diferencia entre:

A. Antígeno y anticuerpo.

B. Sueros y vacunas.


REPERTORIO B

1.- Establezca las diferencias, más significativas, entre el glucógeno y la

celulosa.


2.- Indique los procesos con los que están relacionados los siguientes

orgánulos:

A. Ribosomas.

B. Aparato de Golgi.

C. Cloroplasto.

  1. Retículo endoplásmico liso.

3.- Conteste a las siguientes cuestiones sobre el sobrecruzamiento

(crossingover) de la meiosis:

A.- Fase de la meiosis en que se produce.

B.- Importancia biológica del proceso.


4.- Describa las etapas más importantes del proceso de transcripción en

eucariotas.


5.- El SIDA:

A. Estructura del virus.

B. Aspectos sociales y epidemiológicos.






EXTREMADURA / SEPTIEMBRE 05. LOGSE / BIOLOGIA


REPERTORIO A

1.- Conteste, brevemente, a las siguientes cuestiones sobre los

disacáridos:

A.- Estructura del enlace O-glicosídico.

B.- Enumere las características biológicas más sobresalientes de dos de

ellos.


2.- Diferencias entre transporte activo y pasivo a través de la membrana

celular.

Enumere y comente, brevemente, los diferentes tipos de transporte

pasivo.


3.- Conteste a las siguientes cuestiones sobre el Código Genético:

A. Concepto.

B. Enumere sus principales características.

4.- Fermentación láctica:

A. Descripción del proceso.

B. Aplicación de este proceso en la elaboración de quesos extremeños

con denominación de origen.


5.- Conteste a las siguientes cuestiones sobre las inmunoglobulinas:

A.- Naturaleza química y células responsables de su síntesis.

B.- Importancia de su función biológica.


REPERTORIO B

1.- Establezca las diferencias, más significativas, entre la célula animal y vegetal.


2.- Comente las principales reacciones de la fase luminosa de la fotosíntesis.


3.- Defina los siguientes términos:

A.- Glucólisis.

B.- Fermentación.

C.- Fotosíntesis.

D.- Quimiosíntesis.


4.- Establezca las diferenciasmás significativas, del proceso de

transcripción entre las células procariotas y eucariotas.


5.- Defina los siguientes conceptos:

A. Ingeniería genética.

B. Clonación.










EXAMEN COMPLETO


REPERTORIO A

1. Colesterol:

a. Concepto e importancia biológica. (1,5 puntos)

b. Alimentos extremeños que ayudan a rebajar los niveles de colesterol. (0,5 puntos)


2.- Establezca las diferencias más significativas, entre la célula animal y vegetal.


3.- Conteste que función desempeñan en la fotosíntesis:(0,5 puntos cada apartado)

a. La clorofila.

b. La ATP sintetasa.

c. Un fotosistema.

    d. La ribulosa 1,5-difosfato carboxilasa.

4.- Describa, brevemente, la autoduplicación del ADN.


5.- Defina los siguientes conceptos:

a. Biotecnología. (1 punto)

b. Especies transgénicas. (1 punto)



Examen de Selectividad Extremadura / Junio 2007

Repertorio A


1. Polisacáridos de reserva. 2 ejemplos.

2. Aparato de Golgi: estructura y función.

3. Cadena respiratoria. Fosforilación oxidativa.

4. Concepto de gen.

  1. Diferencias entre sueros y vacunas.

Repertorio B

1. Enzimas: concepto y naturaleza química.

2. Diferencias entre células animales y células vegetales.

3. Recombinación genética: concepto, proceso, finalidad e importancia

biológica.

4. Principales infecciones e infestaciones zoonósicas en Extremadura.

5. Ciclo de un virus bacteriófago.




EXAMEN SELECTIVIDAD BIOLOGÍA JUNIO 2008


OPCIÓN A


1. Fosfolípidos:

A. Estructura.

B. Función.


2. Conteste a las siguientes cuestiones sobre los ribosomas:

A. Composición

B. Diferencias entre ribosomas de células eucariotas y procariotas.

C. Función.

D. Localización.


3. Fermentación Láctica:

A. Concepto.

B. Organismos que las realizan.

C. Cite algún producto extremeño, con denominación de origen, elaborado con este tipo de fermentación.


4. Autoduplicación o replicación del ADN en procariotas.

5. Dibuje una bacteria e indique, en el esquema, cada uno de sus componentes


Opción B


1. Establezca las diferencias entre lípidos saponificables y no saponificables. Ponga un ejemplo de cada uno de ellos.

2. Establezca diferencias entre célula procariota y eucariota.

3. Conteste, brevemente, acerca de la fotosíntesis:

A. Concepto.

B. ¿Qué es un fotosistema?

C. Objetivos de la fase luminosa.

D. Objetivos de la fase oscura.

4. Diferencias fundamentales entre la Metafase I de la meiosis y la Metafase de la mitosis.

5. Defina: Clonación y Especies transgénicas.ECB